STR chr1:55056869-55056885

Motif CG repeats 8 times in the reference sequence.


...GGGCAGTGACCGTCCCTCCTCTGACCCACCACTCCTCCAGTGTCAGGACACTGCGGGTATCTAGGGGAAGGAATCTTGTTCCACTTCAAGTCTGGAACTT
CAAGTCTGTGTGTGTGCGTGGCGCGCGCGCGCGTTGGGGGTGGGGGTTGCAGAGCAGATGCGTACCTGACAGCGGTAACCTAGGTCCCCCCTGGCCTATC
AAGGCTTCCCTGGCGGCCGAATTTAAAGGCATCAAGCAAACAAAGCCCAACACATCT...


Maps to PCSK9, proprotein convertase subtilisin/kexin type 9



No Data Available.

See the about page for detailed description of each parameter.


No eSTRs found.

See the about page for detailed description of each parameter.


No Data Available.

See the about page for detailed description of each parameter.


Locus-level imputation metrics

No Data Available.

Allele-level imputation metrics

No Data Available.

See the about page for detailed description of each parameter.